Lecture 2 — DNA, RNA and Protein

RNA types · transcription · strands and 5′→3′ · translation · mutations · PCR

Lecture 1 introduced the central dogma, DNA → RNA → protein, as a one-line idea. This lecture is the machinery behind that line: how a gene is copied into messenger RNA, how the ribosome reads that RNA three letters at a time, and how a protein comes out the other end.

Once you know how the machinery works, you can describe what happens when it goes wrong. A single changed letter can do nothing (a silent change), swap one amino acid (missense), or stop the protein early (nonsense). Inserting or deleting letters can shift how every following codon is read. These categories are the vocabulary for every mutation in the rest of the course, including the PCSK9 variant D374Y.

The key intuition is the reading frame: the ribosome reads mRNA in fixed groups of three. Most of the mutation rules follow from that one fact.

This page covers RNA vs DNA, transcription and strand terminology, translation and the genetic code, mutation types, the PCSK9 D374Y example and PCR. The strand-and-translate exercise at the bottom is the classic exam-style calculation.

Slides: “Lecture 2_DNA_RNA_protein.pdf” (slide date 3 Sep 2026).

Rough plan: Week 1, day 2. DNA–RNA–Protein.

2.1 RNA vs DNA, and the types of RNA

RNA is chemically similar to DNA but differs in three ways:

DNA RNA
Sugar Deoxyribose Ribose
Bases A, C, G, T (thymine) A, C, G, U (uracil)
Strands Double-stranded Usually single-stranded

Functional types of RNA

RNA Function
mRNA (messenger RNA) Carries genetic information copied from DNA, used for protein synthesis
rRNA (ribosomal RNA) Structural and catalytic component of ribosomes, the machines that build proteins
tRNA (transfer RNA) Brings the correct amino acid to the ribosome, matched to the mRNA codon being read
snRNA (small nuclear RNA) RNA splicing (added in Lecture 3)
miRNA (microRNA) Regulates gene expression (added in Lecture 3)
mRNA, which carries the copied gene sequence
rRNA, which forms the body of the ribosome
tRNA, whose anticodon matches the mRNA codon
miRNA, which binds and silences target mRNAs
Each tRNA carries one specific amino acid and has an anticodon that base-pairs with the codon on the mRNA. mRNA is the message, rRNA is part of the ribosome, miRNA regulates expression.

2.2 Transcription, strands and directionality

Protein synthesis has two steps: transcription and translation. In transcription a gene (a defined stretch of DNA) is copied into mRNA; the mature mRNA is exported from the nucleus and translated in the cytoplasm.

Transcription factors are proteins that bind DNA and increase or decrease the rate of transcription. They are one of the main controls over which genes are “on” in which cell type.

Strand terminology (a frequent source of confusion, be precise):

Term Also called What it is
Template strand Non-coding strand The strand RNA polymerase reads and copies from
Coding strand Non-template strand Same sequence as the mRNA, with T instead of U
mRNA Transcript Made complementary to the template strand, so identical to the coding strand (U for T)
ImportantDirectionality rules (repeated across Lectures 2 and 3)
  • DNA and RNA are always synthesized 5′ → 3′: new nucleotides are added to the 3′ end.
  • The new RNA strand is antiparallel to the DNA template strand. Antiparallel orientation is what makes base pairing physically possible.
  • DNA polymerase needs a primer to start. RNA polymerase does not.

2.2b Worked example: strand, transcribe, translate

This example is from Lecture 3 but tests exactly the concepts above. Be able to do it from scratch.

Task. Given the double-stranded DNA below, and told that RNA polymerase moves right to left, find the coding strand, write it 5′→3′, derive the mRNA and translate it.

5′–ATG TTA GGC TAA CCG AAT GGC CAT TCG TAC–3′
3′–TAC AAT CCG ATT GGC TTA CCG GTA AGC ATG–5′
Step Reasoning Result
1. Which strand is read? RNA is made 5′→3′ and is antiparallel to its template, so the polymerase travels along the template from the template’s 3′ end towards its 5′ end. It starts at the right-hand end, and the strand whose 3′ end is on the right is the top strand. So the top strand is the template (the one physically read) and the bottom strand is not read. Top strand = template; bottom strand = coding strand
2. Coding strand 5′→3′ The bottom strand’s 5′ end is on the right, so read it right to left GTA CGA ATG GCC ATT CGG TTA GCC TAA CAT
3. mRNA Same as coding strand, U for T GUA CGA AUG GCC AUU CGG UUA GCC UAA CAU
4. Find start First AUG AUG GCC AUU CGG UUA GCC UAA
5. Translate AUG=Met, GCC=Ala, AUU=Ile, CGG=Arg, UUA=Leu, GCC=Ala, UAA=STOP Met–Ala–Ile–Arg–Leu–Ala

The practice section at the bottom of the page lets you run the same steps in R.

2.3 Translation and the genetic code

Translation: the ribosome reads the code in the mRNA and builds a protein. It takes place at ribosomes. The genetic code maps three-nucleotide codons to amino acids and has three properties:

Property Meaning
Universal Essentially the same in all known life
Unambiguous Each codon specifies exactly one amino acid
Redundant (degenerate) Most amino acids have several codons (64 codons, 20 amino acids)

tRNA’s role: each tRNA carries a specific amino acid and has an anticodon that base-pairs with the matching codon, delivering the right amino acid at the right moment.

Three stages of translation

  1. Initiation: the ribosome assembles on the mRNA at the start codon (AUG, methionine).
  2. Elongation: amino acids are added one at a time as the ribosome moves along, each linked to the growing chain.
  3. Termination: at a stop codon. The three stop codons are UAA, UAG and UGA, given identically in Lectures 2 and 3. Memorize them.

Gene expression differs between cell types. Human cells have roughly 20,000 genes, but each cell type makes different proteins because different genes are expressed. Expression can be regulated at several stages:

  • chemical/structural modification of DNA or chromatin
  • transcription
  • post-transcriptional modification of RNA
  • mRNA degradation
  • post-translational modification of the protein

This is why having a gene and expressing it are different things, and why RNA and protein measurements depend on tissue and context (the layer table in Lecture 1).

AUG, UAA, UGA
UAA, UAG, UGA
UAA, UAG, AUG
UGA, UGG, UAG
The stop codons are UAA, UAG and UGA. AUG is the start codon (methionine); UGG codes for tryptophan.

2.4 Mutations: substitutions

A mutation is a change in a DNA sequence. The lecture shows near-identical mRNA sequences, each with one letter changed from the reference, to show how small the physical change can be:

5' - AUGACUCCUUGUGGCUCUACAUAA - 3'   (reference)
5' - AUGACCCCUUGUGGCUCUACAUAA - 3'
5' - AUGACUCCUUGUGACUCUACAUAA - 3'
5' - AUGACUCCUUGUGCCUCUACAUAA - 3'
5' - AUGACUCCUUGAGGCUCUACAUAA - 3'

Point mutations (substitutions) swap one nucleotide for another. Also called an SNV (single nucleotide variant); when the change is common in the population it is called an SNP (single nucleotide polymorphism). Same type of change; SNP implies a recurring, population-level variant rather than a one-off.

Effect What happens Consequence
Silent Codon changes but the amino acid does not (code redundancy) Protein unaffected
Missense Codon now codes a different amino acid Structure/function may change
Nonsense Codon becomes a premature stop Protein truncated

Worked on the sequences above (codons AUG ACU CCU UGU GGC UCU ACA UAA = Met–Thr–Pro–Cys–Gly–Ser–Thr–stop):

Line Changed codon Effect
2 ACU → ACC (both Thr) Silent
3 GGC → GAC (Gly → Asp) Missense
4 GGC → GCC (Gly → Ala) Missense
5 UGU → UGA (Cys → stop) Nonsense

2.4b Mutations: indels and chromosomal changes

Indels (insertions and deletions) add or remove one or more nucleotides. The effect depends on how many, because the ribosome reads in fixed groups of three:

Type Number of nucleotides Effect
Frameshift Not a multiple of 3 Every downstream codon is shifted; the rest of the protein is scrambled, often with an early stop
In-frame A multiple of 3 Reading frame preserved; only the affected amino acid(s) are added or removed

Chromosomal alterations affect whole chromosome segments: deletion, duplication, inversion, insertion, translocation.

A frameshift that scrambles all downstream amino acids
A silent change that leaves the protein sequence intact
One amino acid is lost but the reading frame is kept
A premature stop codon at the site of the deletion
Three nucleotides is one codon. The frame downstream is preserved, so the protein simply lacks one amino acid (in-frame deletion). PCSK9 c.290_292delGCC (p.Arg97del) in Lecture 3 is exactly this.

2.5 The PCSK9 mutation D374Y

The specific PCSK9 mutation used as the running example is D374Y, written at three levels:

Level Notation
Plain (old style) D374Y: aspartic acid (D) at position 374 changed to tyrosine (Y)
DNA level c.1120G>T
Combined PCSK9 c.1120G>T (p.Asp374Tyr)

Lecture 3 (Section 3.3) covers the full HGVS rules for reading and writing this notation, and explains why D374Y is a gain-of-function mutation.

2.6 PCR: polymerase chain reaction

PCR amplifies (makes many copies of) a specific region of DNA in vitro (in a test tube). “Worth a Nobel Prize”: Kary Mullis won the 1993 Nobel Prize in Chemistry for it.

Component Role
Taq polymerase A heat-stable DNA polymerase. It survives the repeated heating steps PCR needs, unlike most enzymes
Primers Short DNA sequences that mark the start points and so define which region is amplified

PCR underlies many methods in this course: TaqMan SNP genotyping (Lecture 3) and amplifying a small region around a suspected mutation before sequencing in AML diagnostics (Lecture 3).

Taq polymerase needs no primers to start synthesis
Taq polymerase survives the repeated heating steps
Taq polymerase copies RNA as well as DNA templates
Taq polymerase reads the strand in the 3′ to 5′ direction
PCR repeatedly heats the sample to separate the strands. Taq is heat-stable, so it survives every cycle. It still needs primers, which define the amplified region.

Practice

NoteStrand → mRNA → protein in R

The code runs in your browser (the first run takes a few seconds while R loads). The function below does the steps from Section 2.2b. Run it, then try the tasks.

Tasks

  1. Change one letter in coding so that the Leu codon (UUA) becomes a stop codon. Which mutation type is that?
  2. Make a silent change in the first Ala codon (GCC).
  3. Delete one letter right after the start codon and rerun. What happens to the protein, and what is this mutation called?
  1. UUA → UAA. In the coding strand, replace CGGTTAGCC with CGGTAAGCC. The protein stops after Met–Ala–Ile–Arg: a nonsense mutation.
  2. GCC → GCA, GCU or GCG: still Ala. For example replace ATGGCC with ATGGCA. A silent mutation.
  3. Deleting one letter shifts the reading frame: every codon after the deletion changes, and the stop codon ends up somewhere else (or disappears from the sequence). A frameshift mutation.

Why-questions

Because its sequence matches the mRNA (with T for U), and therefore codes for the protein in the sense that you can read the codons directly off it. The template strand is the one physically read by RNA polymerase.

The genetic code is redundant: 64 codons encode 20 amino acids plus stop. Many substitutions, especially in the third position of a codon, turn one codon into a synonym for the same amino acid.

The ribosome reads in triplets. Removing one letter shifts every following codon (frameshift), scrambling the rest of the protein. Removing three letters removes exactly one codon and keeps the frame.

Spaced review

DNA / genetic variation
RNA / gene expression
Protein abundance
Metabolite levels
DNA is essentially fixed for life. RNA and proteins are dynamic and tissue-specific; metabolites change fastest of all.

Further reading

Links from the course’s reading guide (“Reading links connected to lectures” on Canvas). IB = Introductory Biology (CK-12), GB = General Biology (Boundless), MG = Modern Genetics, all on LibreTexts.

Reading

Videos, exercises and activities